• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Method to determine the geographical descent of a subject. The present invention relates to methods for determining the geographical descent of a subject based on the determination of the sequence of a panel of 7 simple nucleotide polymorphisms. The invention also relates to kits for carrying out said methods and their uses. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2609130A1
    申请号:ES201531475
    申请日:2015-10-14
    公开日:2017-04-18
    发明作者:Carlos Alberto FLORES INFANTE；José Marcos MORENO VEGA；Santiago BASALDÚA LEMARCHAND
    申请人:SERVICIO CANARIO DE SALUD；Universidad de La Laguna；
    IPC主号:
    专利说明:

    image 1
    image2
    image3
    image4
    image5
    image6
    image7
    -Oceania: the term "Oceania", as used here, refers to the continent of the same name. The person skilled in the art will understand that the determination of the method of
    invention is made with a certain probability and therefore does not have to be
    5 correct for 100% of the subjects evaluated, although for a statistically significant part of the subjects. That is, the method of the invention allows to correctly determine the geographical ancestry in a statistically significant part of the subjects. If a part is statistically significant, it can be determined without further processing by the person skilled in the art
    10 using several well-known statistical evaluation tools, for example, the determination of confidence intervals, determination of p-value, cross-validation with classification indices, etc. (more details in “Research statistics” Dowdy and Wearden, John Wiley & Sons, New York, 1983). Preferred confidence intervals are at least 50%, at least 60%, at least 70%, at
    15 minus 80%, at least 90% or at least 95%. P values are preferably 0.01, 0.005 or less. The term "subject", as used herein, refers to a human being of any age or sex. In a particular embodiment, the subject does not belong to the populations of Japan, Kalash or Hazaras, nor to populations from historical crossings (such
    20 as, for example, those of the Caribbean or African American). The first stage of the method of the invention comprises determining in a sample comprising genetic material of said subject the genotype of the two alleles of the single nucleotide polymorphisms (SNP) rs1257016, rs971779, rs238547, rs1482326, rs4760332, rs2104388, and rs2427622 and, optionally, any other
    25 polymorphism found in linkage imbalance with any of the above, in both alleles. The term "single nucleotide polymorphism" or "SNP" ("single nucleotide polymorphism") or simply "polymorphism", as used herein, refers to a variation in the nucleotide sequence of a nucleic acid that be
    30 produces in a single nucleotide (A, C, T or G), where each possible sequence is present in a proportion equal to or greater than 1% of the population. SNPs are usually referred to according to the registration number in the SNP database (dbSNP) at the National Center for Biotechnology Information (NCBI, accessible at http://www.ncbi.nlm.nih.gov/projects/SNP/. In general, SNPs represent one of the
    35 most common forms of genetic variations. These polymorphisms appear when a single nucleotide in the genome is altered (for example, by substitution,
    image8
    image9
    In a particular embodiment, SNPs that are in linkage disequilibrium with SNP rs971779 are located in the region between nucleotide 66164517 and nucleotide 66277698 of chromosome 12 according to the coordinates of the human genome version hg19.
    5 In a particular embodiment, SNPs that are in linkage disequilibrium with SNP rs238547 are located in the region between nucleotide 23356312 and nucleotide 23369090 of chromosome 16 according to the coordinates of the human genome version hg19.
    In a particular embodiment, SNPs that are in imbalance of
    The linkage with SNP rs1482326 is located in the region between nucleotide 69794071 and nucleotide 69794071 of chromosome 6 according to the coordinates of the human genome version hg19.
    In a particular embodiment, SNPs that are in linkage disequilibrium with SNP rs4760332 are located in the region between nucleotide 58219173 and nucleotide 58337671 of chromosome 12 according to
    coordinates of the human genome version hg19.
    In a particular embodiment, SNPs that are in linkage disequilibrium with SNP rs2104388 are located in the region between nucleotide 74674871 and nucleotide 74710374 of chromosome 13 according to
    20 coordinates of the human genome version hg19. In a particular embodiment, SNPs that are in linkage disequilibrium with SNP rs2427622 are located in the region between nucleotide 62829408 and nucleotide 62911117 of chromosome 20 according to the coordinates of the human genome version hg19.
    In a particular embodiment, the method of the invention allows determining, with a high probability, the geographical ancestry of the subject depending on the genotype present in each of the polymorphisms rs1257016, rs971779, rs238547, rs1482326, rs4760332, rs2104388, and rs2427622. The term "genotype of the two alleles" or simply "genotype" applied to a polymorphism or SNP, as here
    30 uses, refers to the specific alleles present in the two homologous chromosomes for the polymorphic position of said SNP. Thus, in a particular embodiment, - the GG genotype in the rs1257016 polymorphism, - the CC genotype in the rs971779 polymorphism,
    35 -the TC genotype in the rs238547 polymorphism, -the AG genotype in the rs1482326 polymorphism,

    - the CC genotype in the rs4760332 polymorphism, - the GG genotype in the rs2104388 polymorphism and - the AG genotype in the rs2427622 polymorphism
    indicate that there is a high probability that the geographical ancestry of the 5 subject is European.
    In another particular embodiment, - the GG genotype in the rs1257016 polymorphism, - the TT genotype in the rs971779 polymorphism, - the CC genotype in the rs238547 polymorphism,
    10 -the GG genotype in the rs1482326 polymorphism, -The CC genotype in the rs4760332 polymorphism, -The AA genotype in the rs2104388 polymorphism and -The GG genotype in the rs2427622 polymorphism
    indicate that there is a high probability that the geographical ancestry is 15 sub-Saharan Africa,
    In another particular embodiment, - the GG genotype in the rs1257016 polymorphism, - the CC genotype in the rs971779 polymorphism, - the CC genotype in the rs238547 polymorphism,
    20 -the GG genotype in the rs1482326 polymorphism, -The CC genotype in the rs4760332 polymorphism, -The AG genotype in the rs2104388 polymorphism and -The GG genotype in the rs2427622 polymorphism
    indicate that there is a high probability that geographical ancestry is
    25 Middle East and North Africa. In another particular embodiment, the AG genotype in the rs1257016 polymorphism, the CC genotype in the rs971779 polymorphism, the CC genotype in the rs238547 polymorphism,
    30 -the genotype AG in the polymorphism rs1482326, -the genotype AC in the polymorphism rs4760332, -the genotype AG in the polymorphism rs2104388 and -the genotype AG in the polymorphism rs2427622
    They indicate that there is a high probability that the geographical ancestry is 35 Central and South Asia. In another particular embodiment,

    - the AG genotype in the rs1257016 polymorphism, - the CC genotype in the rs971779 polymorphism, - the CC genotype in the rs238547 polymorphism, - the AA genotype in the rs1482326 polymorphism,
    5 -the AC genotype in the rs4760332 polymorphism, the GG genotype in the rs2104388 polymorphism and
    - The AA genotype in the rs2427622 polymorphism indicates that there is a high probability that the geographical ancestry is East Asia.
    10 In another particular embodiment, - the AA genotype in the rs1257016 polymorphism, - the CC genotype in the rs971779 polymorphism, - the TT genotype in the rs238547 polymorphism, - the AG genotype in the rs1482326 polymorphism,
    15 - the AA genotype in the rs4760332 polymorphism, - the GG genotype in the rs2104388 polymorphism and - the AA genotype in the rs2427622 polymorphism indicate that there is a high probability that the geographic ancestry is America.
    In another particular embodiment, the AA genotype in the rs1257016 polymorphism, the TT genotype in the rs971779 polymorphism, the CC genotype in the rs238547 polymorphism, the AA genotype in the rs1482326 polymorphism,
    25 - the CC genotype in the rs4760332 polymorphism, - the AA genotype in the rs2104388 polymorphism and - the AA genotype in the rs2427622 polymorphism indicate that there is a high probability that the geographical ancestry is Oceania.
    30 The term "high probability", as used herein, means a probability of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at at least 95%, at least 97%, at least 99% or a
    100. In a particular embodiment, high probability is at least 70%, preferably at least 75%.
    The proportion of successes of the classification of the method of the invention can be increased by adding to the panel of the 7 SNPs described combinations of 5 additional SNPs, as shown in Figures 2 and 3. Thus, in a particular embodiment, The method of the invention further comprises determining the sequence of one of the following groups of 5 SNPs:
    (i) The group formed by polymorphisms:
    5 -rs186471, which corresponds to the sequence TATTGATTGGGTGGAATATAAATGT [A / G] GGTATGTGTGTGTGTATA AGAC, of SEQ ID NO: 8
    -rs7919248, which corresponds to the sequence GCCAAAGAAGAGGCGATTCACAGCA [G / T] AAATGAATTTGATAAAA 10 ATAAA, of SEQ ID NO: 9
    -rs2231997, located in the DDX49 gene and corresponding to the sequence ACCACCTGCCCAGCCCTGCCTCTCA [C / T] GCTCTGTCCCCCAGAC ATGGTG, of SEQ ID NO: 10,
    15 -rs581468, located in the ARHGAP42 gene, and corresponding to the sequence CAGAAGCTAAACCACCATTCTTTCC [A / G] ACACTGTCTCAGAGACT TGGAA, of SEQ ID NO: 11; Y
    -rs1609997, which corresponds to the sequence 20 GCCCTCTTTTTAAGTAACTTTCCTG [A / G] AGACACAACCAAACTTCC ACTT, of SEQ ID NO: 12.
    In a particular embodiment, the GG genotype in the rs186471 polymorphism, the TT genotype in the rs7919248 polymorphism, the CC genotype in the rs2231997 polymorphism, the AG genotype in the rs581468 polymorphism and the GG genotype in the
    25 polymorphism rs1609997, indicate that there is a high probability that the geographical ancestry is European. In a particular embodiment, the GG genotype in the rs186471 polymorphism, the TT genotype in the rs7919248 polymorphism, the CC genotype in the rs2231997 polymorphism, the AA genotype in the rs581468 polymorphism and the AA genotype in the
    30 polymorphism rs1609997, indicate that there is a high probability that the geographical ancestry is sub-Saharan Africa. In a particular embodiment, the GG genotype in the rs186471 polymorphism, the TT genotype in the rs7919248 polymorphism, the CC genotype in the rs2231997 polymorphism, the AA genotype in the rs581468 polymorphism and the AG genotype in the
    35 polymorphism rs1609997, indicate that there is a high probability that the geographical ancestry is Near East and North Africa.
    In a particular embodiment, the GG genotype in the rs186471 polymorphism, the TT genotype in the rs7919248 polymorphism, the CC genotype in the rs2231997 polymorphism, the AG genotype in the rs581468 polymorphism and the AG genotype in the high rs1609997 polymorphism, indicate that there is a high probability that the
    5 geographical ancestry be Central and South Asia.
    In a particular embodiment, the AA genotype in the rs186471 polymorphism, the TG genotype in the rs7919248 polymorphism, the TC genotype in the rs2231997 polymorphism, the GG genotype in the rs581468 polymorphism and the AA genotype in the rs1609997 polymorphism, indicate that there is a high probability that the
    10 geographical ancestry be East Asia. In a particular embodiment, the AG genotype in the rs186471 polymorphism, the GG genotype in the rs7919248 polymorphism, the CC genotype in the rs2231997 polymorphism, the GG genotype in the rs581468 polymorphism and the AA genotype in the rs1609997 high polymorphism, indicate that probability that the
    15 geographical ancestry be America. In a particular embodiment, the AA genotype in the rs186471 polymorphism, the TG genotype in the rs7919248 polymorphism, the TT genotype in the rs2231997 polymorphism, the GG genotype in the rs581468 polymorphism and the AA genotype in the rs1609997 polymorphism, indicate that there is a high probability that the
    20 geographical ancestry be Oceania.
    (ii) The group formed by polymorphisms:
    -rs1765857, located in the LOC105370158 gene and corresponding to the sequence TCTTATGAAAGATGTGCCAATTAAT [A / G] CGATGCTGCATTTTCTTA
    25 CTATTCC, of SEQ ID NO: 13, -rs10497520, located in the TTN gene and corresponding to the sequence AATCCAGGTGCTGTTTCTCCAACTT [C / T] AGGTTCTTGAACAAATGC AGTC, of SEQ ID NO: 14,
    30 -rs9552445, located in the MICU2 gene and corresponding to the sequence TACAAATAAACAAGGTAGTTCTACA [A / G] CAGCATTCTAGGCATTTG CCCT, of SEQ ID NO: 15,
    -rs12880675, which corresponds to the sequence 35 GAACTAATTATTTTATTGATTCAAG [C / G / T] AGCAATGGTTCTAAATC AGA, of SEQ ID NO: 16 and
    -rs350886, located in the MAK2K2 gene, and corresponding to the sequence GAGCCCCCAGGCGATGGCGGCTCTC [A / G] CCAAAAGGAAGGAGA GTGAGGC, of SEQ ID NO: 17.
    5 In a particular embodiment, the AA genotype in the rs1765857 polymorphism, the CC genotype in the rs10497520 polymorphism, the AA genotype in the rs9552445 polymorphism, the CC genotype in the rs12880675 polymorphism and the GG genotype in the rs350886 polymorphism, indicate that rs350886 exists high probability that the geographical ancestry is European.
    10 In a particular embodiment, the AA genotype in the rs1765857 polymorphism, the TT genotype in the rs10497520 polymorphism, the AA genotype in the rs9552445 polymorphism, the CC genotype in the rs12880675 polymorphism and the AA genotype in the rs350886 polymorphism indicate that a350886 exist, high probability that the geographical ancestry is sub-Saharan Africa.
    In a particular embodiment, the AA genotype in the rs1765857 polymorphism, the CC genotype in the rs10497520 polymorphism, the AA genotype in the rs9552445 polymorphism, the CC genotype in the rs12880675 polymorphism and the AG genotype in the rs350886 polymorphism indicate that there exist a350886, high probability that the geographical ancestry is the Middle East and North Africa.
    In a particular embodiment, the AA genotype in the rs1765857 polymorphism, the CC genotype in the rs10497520 polymorphism, the AA or AG genotype in the rs9552445 polymorphism, the CC genotype in the rs12880675 polymorphism and the GG genotype in the rs350 polymorphism, rs350 there is a high probability that the geographical ancestry is Central and South Asia.
    In a particular embodiment, the GG genotype in the rs1765857 polymorphism, the TT genotype in the rs10497520 polymorphism, the GG genotype in the rs9552445 polymorphism, the TT genotype in the rs12880675 polymorphism and the GG genotype in the rs350 polymorphism, indicate that a rs350 exists high probability that the geographical ancestry is east of Asia.
    In a particular embodiment, the GG genotype in the rs1765857 polymorphism, the TT genotype in the rs10497520 polymorphism, the AG genotype in the rs9552445 polymorphism, the CC genotype in the rs12880675 polymorphism and the GG genotype in the rs3506 polymorphism, indicate that rs3506 high probability that the geographic ancestry is America.
    In a particular embodiment, the AG genotype in the rs1765857 polymorphism, the TT genotype in the rs10497520 polymorphism, the GG genotype in the polymorphism
    image10
    image11
    In a particular embodiment, the AA genotype in the rs6542787 polymorphism, the TT genotype in the rs7919248 polymorphism, the GG genotype in the rs261532 polymorphism, the AA genotype in the rs5996039 polymorphism and the TT genotype in the rs2268969 high polymorphism, indicate that probability that the
    5 geographical ancestry be European.
    In a particular embodiment the AG genotype in the rs6542787 polymorphism, the TT genotype in the rs7919248 polymorphism, the TT genotype in the rs261532 polymorphism, the GG genotype in the rs5996039 polymorphism and the TT genotype in the rs2268969 polymorphism, indicate that there is a high probability That the
    10 geographical ancestry be sub-Saharan Africa. In a particular embodiment, the AA genotype in the rs6542787 polymorphism, the TT genotype in the rs7919248 polymorphism, the TG genotype in the rs261532 polymorphism, the AA genotype in the rs5996039 polymorphism and the TT genotype in the rs2268969 high polymorphism, indicate that there is a high probability that the
    15 geographical ancestry is the Middle East and North Africa. In a particular embodiment, the AA genotype in the rs6542787 polymorphism, the TT genotype in the rs7919248 polymorphism, the GG genotype in the rs261532 polymorphism, the AG genotype in the rs5996039 polymorphism and the TC genotype in the rs2268969 high polymorphism indicate that probability that the
    20 geographical ancestry be Central and South Asia. In a particular embodiment, the GG genotype in the rs6542787 polymorphism, the TG genotype in the rs7919248 polymorphism, the GG genotype in the rs261532 polymorphism, the AA genotype in the rs5996039 polymorphism and the CC genotype in the rs2268969 polymorphism indicate that there is a high probability that the
    25 geographical ancestry be east of Asia. In a particular embodiment, the GG genotype in the rs6542787 polymorphism, the GG genotype in the rs7919248 polymorphism, the GG genotype in the rs261532 polymorphism, the GG genotype in the rs5996039 polymorphism and the TC genotype in the rs2268969 polymorphism, indicate that there is a high rs2268969 probability that the
    30 geographical ancestry be America. In a particular embodiment, the GG genotype in the rs6542787 polymorphism, the TG genotype in the rs7919248 polymorphism, the TT genotype in the rs261532 polymorphism, the AA genotype in the rs5996039 polymorphism and the CC genotype in the rs2268969 high polymorphism indicate that probability that the
    35 geographical ancestry be Oceania.
    (v) The group formed by polymorphisms:
    image12
    image13
    image14
    image15
    image16
    rs1257016 rs971779rs238547rs1482326
    Population AAAGGGTTTCDCTTTCDCAAAGGG
    EUR 0.0130.1440.8440.0130.2310.7560.1940.4940.3130.0880.4630.450
    AFR 0.1740.3550.4710.9590.0410.0000.0000.0170.9830.0000.0580.942
    MEA 0.0450.3070.6480.1360.4090.4550.1140.3810.5060.0450.2560.699
    CSA 0,2470.4300.3230.1580.3860.4560.0450.3990.5670.2970.3800.323
    EAS 0.3260.4970.1770.1160.4310.4530.0000.0330.9670.7180.2540.028
    Love 0.8330.1670.0000.0090.0650.9260.7870.1940.0190.2590.5280.213
    OCE 0.9720.0280.0000.7220.2500.0280.0000.0001,0000.8890.1110.000
    rs4760332 rs2104388rs2427622
    Population AAACDCAAAGGGAAAGGG
    EUR 0.0750.3750.5500,1130,3630.5250.1810.4380.381
    AFR 0.0000.0170.9830.9830.0170.0000.0000.0001,000
    MEA 0.0110.1530.8350.2730.4660.2610.0400.2050.756
    CSA 0.2220.4940.2850.2220.4300,3480.0950.5130.392
    EAS 0.4360.4970.0660.0110.2210.7680.6520.3090.039
    Love 0.8800,1200.0000.0190.2590.7220.7500.1850.065
    OCE 0.2220.3060.4720.7220.2780.0000.5560.3610.083
    Table 1. Probability of assignment of each genotype of each SNP. EUR: Europe; AFR: Sub-Saharan Africa; MEA: Middle East and North Africa; CSA: Central-South Asia, EAS: East Asia; AME: America; OCE: Oceania.
    image17
    image18
    image19
    image20
    image21
    image22
    image23
    image24
    image25
    rs186471 rs7919248rs2231997rs581468
    Population AAAGGGGGTGTTDCTCTTAAAGGG
    EUR 0.0000.1380.8630.0000.1190.8810.4880.4440.0690,3440.4380.219
    AFR 0.1580.4170.4250.0080.1240.8680.9830.0170.0000.5620.3640.074
    MEA 0.0060.1880.8070.0000.1820.8180.8070.1820.0110.4940.4200.085
    CSA 0.1140.3860.5000.1080,3480.5440.4430.4180.1390.2030.4810.316
    EAS 0.5780.3780.0440.2930.4970.2100.1110.4500.4390.0000.1050.895
    Love 0.2690.5090.2220.9440.0460.0090.6300.3150.0560.0190.0650.917
    OCE 0.9440.0280.0280.2500.3990.3610.0000.1140.8860.0000.0001,000
    rs1609997
    Population AAAGGG
    EUR 0.0630.3560.581
    AFR 0.9010.0990.000
    MEA 0.1140.5230.364
    CSA 0.1580.4110.430
    EAS 0.8560.1440.000
    Love 0.7780.1940.028
    OCE 0.9720.0280.000
    Table 3. Probability of assigning a sample to a population division based on the genotype of each SNP of supplement No. 1. EUR: Europe; AFR: Sub-Saharan Africa; MEA: Middle East and North Africa; CSA: Central-South Asia, EAS: East Asia; AME: America; OCE: Oceania.
    rs1765857 rs10497520rs9552445rs12880675
    Population AAAGGGDCTCTTAAAGGGDCTCTT
    EUR 0.8880.1060.0060.7810.1750.0440.7250.2440.0310.7000.2810.019
    AFR 0.5040.3550,1400.0580.3720.5701,0000.0000.0000.7440.2310.025
    MEA 0.8070,1700.0230.7900.1990.0110.6480.2900.0630.8130.1820.006
    CSA 0.5380.3670.0950.4680.4240.1080.4050.4050.1900.5820.3610.057
    EAS 0.0440.3040.6520.0550.3540.5910.1270.4090.4640.0330.3370.630
    Love 0.0090,1200.8700.0190.0560.9260.2040.4170.3800.6570.2870.056
    OCE 0,3330.3610.3060.1940.3060.5000.0000.1670.8330.0000.0560.944
    rs350886
    Population AAAGGG
    EUR 0.1310.3560.513
    AFR 0.9170.0830.000
    MEA 0.2630.4860.251
    CSA 0.1270.4200.452
    EAS 0.0000.1440.856
    Love 0.0000.0090.991
    OCE 0.3710.4290.200
    Table 4. Probability of assigning a sample to a population vision based on the genotype of each SNP of supplement No. 2. EUR: Europe; AFR: Sub-Saharan Africa; MEA: Middle East and North Africa; CSA: Central-South Asia, EAS: East Asia; AME: America; OCE: Oceania.
    rs2384319 rs7919248rs2389736rs2166624
    Population GGTGTTGGTGTTAAAGGGAAAGGG
    EUR 0.0130.1690.8190.0000.1190.8810.0000.0940.9060.1750.4190.406
    AFR 0.0080.2980.6940.0080.1240.8680.6860.2640.0500.0080.0000.992
    MEA 0.0170.2560.7270.0000.1820.8180.0400.2560.7050.0630.3240.614
    CSA 0.0510.3730.5760.1080,3480.5440.0000.2280.7720.0890.4490.462
    EAS 0.8670,1100.0220.2930.4970.2100.1600.4360.4030.2040.4310,365
    Love 0.8330.1390.0280.9440.0460.0090.6300.3060.0650.9630.0370.000
    OCE 0.1110.1940.6940.2500.3990.3610.5560.3060.1390.0000.0001,000
    rs2268969
    Population DCTCTT
    EUR 0.0440.2630.694
    AFR 0.0000.0001,000
    MEA 0.0280.1590.813
    CSA 0.1650.4300.405
    EAS 0.6630.3040.033
    Love 0.3060.5370.157
    OCE 0.5280.4440.028
    Table 5. Probability of assigning a sample to a population division based on the genotype of each SNP of supplement No. 3. EUR: Europe; AFR: Sub-Saharan Africa; MEA: Middle East and North Africa; CSA: Central-South Asia, EAS: East Asia; AME: America; OCE: Oceania.
    rs6542787 rs7919248rs261532rs5996039
    Population AAAGGGGGTGTTGGTGTTAAAGGG
    EUR 0.7310.2440.0250.0000.1190.8810.5060.3810,1130.6810.2880.031
    AFR 0.2480.5370.2150.0080.1240.8680.0080.0660.9260.1650.3640.471
    MEA 0.6190.3180.0630.0000.1820.8180.2780.4600.2610.5280.3580.114
    CSA 0.6900.2590.0510.1080,3480.5440.4180.4110.1710.4490.4770.063
    EAS 0.0170.1600.8230.2930.4970.2100.7350.2430.0220.8180.1660.017
    Love 0.0460.1670.7870.9440.0460.0090.9810.0190.0000.0090.0370.954
    OCE 0.0280.3060.6670.2500.3990.3610.1110.3610.5280.9440.0280.028
    rs2268969
    Population DCTCTT
    EUR 0.0440.2630.694
    AFR 0.0000.0001,000
    MEA 0.0280.1590.813
    CSA 0.1650.4300.405
    EAS 0.6630.3040.033
    Love 0.3060.5370.157
    OCE 0.5280.4440.028
    Table 6. Probability of assigning a sample to a population division based on the genotype of each SNP of supplement No. 4. EUR: Europe; AFR: Sub-Saharan Africa; MEA: Middle East and North Africa; CSA: Central-South Asia, EAS: East Asia; AME: America; OCE: Oceania.
    rs6542787 rs7919248rs261532rs8139993
    Population AAAGGGGGTGTTGGTGTTDCTCTT
    EUR 0.7310.2440.0250.0000.1190.8810.5060.3810,1130.0310.2880.681
    AFR 0.2480.5370.2150.0080.1240.8680.0080.0660.9260.4710.3640.165
    MEA 0.6190.3180.0630.0000.1820.8180.2780.4600.2610.1140.3580.528
    CSA 0.6900.2590.0510.1080,3480.5440.4180.4110.1710.0630.4770.449
    EAS 0.0170.1600.8230.2930.4970.2100.7350.2430.0220.0170.1660.818
    Love 0.0460.1670.7870.9440.0460.0090.9810.0190.0000.9540.0370.009
    OCE 0.0280.3060.6670.2500.3990.3610.1110.3610.5280.0280.0280.944
    rs2268969
    Population DCTCTT
    EUR 0.0440.2630.694
    AFR 0.0000.0001,000
    MEA 0.0280.1590.813
    CSA 0.1650.4300.405
    EAS 0.6630.3040.033
    Love 0.3060.5370.157
    OCE 0.5280.4440.028
    Table 7. Probability of assigning a sample to a population division based on the genotype of each SNP of supplement No. 5. EUR: Europe; AFR: Sub-Saharan Africa; MEA: Middle East and North Africa; CSA: Central-South Asia, EAS: East Asia; AME: America; OCE: Oceania.
    rs3784651 rs10497520rs261532rs12880675
    Population DCTCTTDCTCTTGGTGTTDCTCTT
    EUR 0.0190.2130.7690.7810.1750.0440.5060.3810,1130.7000.2810.019
    AFR 0.4710,3470.1820.0580.3720.5700.0080.0660.9260.7440.2310.025
    MEA 0.0450.4150.5400.7900.1990.0110.2780.4600.2610.8130.1820.006
    CSA 0,1200.4490.4300.4680.4240.1080.4180.4110.1710.5820.3610.057
    EAS 0.5470.4090.0440.0550.3540.5910.7350.2430.0220.0330.3370.630
    Love 0.0090.2780.7130.0190.0560.9260.9810.0190.0000.6570.2870.056
    OCE 1,0000.0000.0000.1940.3060.5000.1110.3610.5280.0000.0560.944
    rs4742634
    Population DCTCTT
    EUR 0.6000,3630.038
    AFR 0.0170.1740.810
    MEA 0.4490.4660.085
    CSA 0.1900.5190.291
    EAS 0.0220.2710.707
    Love 0.0090.0740.917
    OCE 0.0000.0280.972
    Table 8. Probability of assigning a sample to a population division based on the genotype of each SNP of supplement No. 6. EUR: Europe; AFR: Sub-Saharan Africa; MEA: Middle East and Nort Africa; CSA: Central-South Asia, EAS: East Asia; AME: America; OCE: Oceania.
    image26
    权利要求:
    Claims (1)
    [1]
    image 1
    image2
    image3
    image4
    类似技术:
    公开号 | 公开日 | 专利标题
    Benayoun et al.2019|Remodeling of epigenome and transcriptome landscapes with aging in mice reveals widespread induction of inflammatory responses
    Pérez O’Brien et al.2014|Assessing signatures of selection through variation in linkage disequilibrium between taurine and indicine cattle
    Daub et al.2013|Evidence for polygenic adaptation to pathogens in the human genome
    Rueda et al.2009|The STAT4 gene influences the genetic predisposition to systemic sclerosis phenotype
    Vogt2005|AZF deletions and Y chromosomal haplogroups: history and update based on sequence
    Derenko et al.2010|Origin and post-glacial dispersal of mitochondrial DNA haplogroups C and D in northern Asia
    Cheng et al.2014|Assessing single nucleotide variant detection and genotype calling on whole-genome sequenced individuals
    Goodhead et al.2013|Whole-genome sequencing of Trypanosoma brucei reveals introgression between subspecies that is associated with virulence
    Schousboe et al.2015|Multiple origins of mutations in the mdr1 gene—a putative marker of chloroquine resistance in P. vivax
    Butali et al.2019|Genomic analyses in African populations identify novel risk loci for cleft palate
    Song et al.2013|SNPs and interaction analyses of IRF6, MSX1 and PAX9 genes in patients with non‑syndromic cleft lip with or without palate
    Govatati et al.2017|Association of mitochondrial displacement loop polymorphisms with risk of colorectal cancer in south Indian population
    García‐Fernández et al.2011|The role of bovine causal genes underlying dairy traits in Spanish Churra sheep
    Cortes et al.2013|Resequencing and fine-mapping of the chromosome 12q13-14 locus associated with multiple sclerosis refines the number of implicated genes
    Rougeron et al.2020|Human Plasmodium vivax diversity, population structure and evolutionary origin
    Engelhardt et al.2017|Identification of heterozygous single-and multi-exon deletions in IL7R by whole exome sequencing
    ES2609130A1|2017-04-18|Method for determining the geographical descent of a subject |
    Vafin et al.2014|Genotypic identification of the bovine leukemia virus
    Nathalang et al.2015|Duffy blood group genotyping in Thai blood donors
    Das et al.2020|Investigating the likely association between genetic ancestry and COVID-19 manifestations
    Segat et al.2009|Secreted protein acidic and rich in cysteine | gene polymorphism association with hepatocellular carcinoma in Italian patients
    Reiisi et al.2016|Screening of DFNB3 in Iranian families with autosomal recessive non-syndromic hearing loss reveals a novel pathogenic mutation in the MyTh4 domain of the MYO15A gene in a linked family
    Schor et al.2018|Lack of association between single-nucleotide polymorphisms of pro-and anti-inflammatory cytokines and HTLV-1-associated myelopathy/tropical spastic paraparesis development in patients from Rio de Janeiro, Brazil
    KR20110021095A|2011-03-04|Snp markers for sex determination and/or human identification
    January et al.2020|HLA-C* 04: 01 is a Genetic Risk Allele for Severe Course of COVID-19
    同族专利:
    公开号 | 公开日
    ES2609130B1|2018-01-25|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US20070037182A1|2002-05-28|2007-02-15|Gaskin James Z|Multiplex assays for inferring ancestry|
    US20070003944A1|2004-12-14|2007-01-04|Sinha Sudhir K|Inference of human geographic origins using Alu insertion polymorphisms|
    RU2758077C1|2020-11-16|2021-10-26|Федеральное государственное бюджетное учреждение науки Институт общей генетики им. Н.И. Вавилова Российской академии наук |Method for determining ethno-geographical group of origin and territory of origin of an individual and panel of single-nucleotide polymorphisms|
    法律状态:
    2018-01-25| FG2A| Definitive protection|Ref document number: 2609130 Country of ref document: ES Kind code of ref document: B1 Effective date: 20180125 |
    2018-07-31| FA2A| Application withdrawn|Effective date: 20180725 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201531475A|ES2609130B1|2015-10-14|2015-10-14|Method to determine the geographic ancestry of a subject|ES201531475A| ES2609130B1|2015-10-14|2015-10-14|Method to determine the geographic ancestry of a subject|
    [返回顶部]